Photos / Sounds

What

Star Jellies (Genus Nostoc)

Observer

teellbee

Date

May 2, 2022 12:15 PM PDT

Photos / Sounds

What

Anna's Hummingbird (Calypte anna)

Observer

lilbabybaba

Date

April 30, 2022 04:35 PM PDT

Photos / Sounds

What

Oxalis Rust (Puccinia oxalidis)

Observer

catchang

Date

May 2, 2022 07:20 PM PDT

Photos / Sounds

What

Wafer-lid Trapdoor Spiders (Family Euctenizidae)

Date

June 13, 2021 07:16 PM PDT

Photos / Sounds

What

Common Candy-striped Spider (Enoplognatha ovata)

Observer

ryanphelansf

Date

August 16, 2021 01:10 PM UTC

Description

Appears to have an egg bundle suspended in its web

Macro photos courtesy of @rhiannonsf

Photos / Sounds

What

Western Black Widow (Latrodectus hesperus)

Observer

spencer_holmes

Date

August 16, 2021 01:08 PM PDT

Photos / Sounds

What

California Turret Spider (Atypoides riversi)

Observer

quiverquercus

Date

April 25, 2021 06:23 PM PDT

Photos / Sounds

What

Pacific Poison Oak (Toxicodendron diversilobum)

Observer

alexandre164

Date

July 17, 2021 02:05 PM UTC

Photos / Sounds

What

Vertebrates (Subphylum Vertebrata)

Observer

birdingman

Date

April 20, 2021 04:49 AM PDT

Description

eBird reviewer said it wasn't a bird. Any mammal experts out there have an idea?

Photos / Sounds

Observer

natashaelisa

Date

January 2021

Photos / Sounds

Observer

brennanpopovic

Date

January 12, 2021 04:47 PM UTC

Photos / Sounds

What

Roundheads (Genus Stropharia)

Observer

michael_maydeck

Date

January 15, 2021 01:31 PM UTC

Description

Found under brush on a bank along the trail.

Photos / Sounds

Observer

pogon

Date

January 5, 2021 11:12 AM PST

Description

on oak

Photos / Sounds

What

Long-tailed Shrews (Genus Sorex)

Observer

tparkeressig

Date

March 12, 2019 05:16 PM UTC

Description

Managed to help it out of the large pot it had got trapped in.

Photos / Sounds

Observer

pogon

Date

October 17, 2020 09:30 AM PDT

Description

In Tilden Park on dead Bay Laural. I originally thought it was a Stereum sp. but it looked a little different, and the host was usual. The specimen, which was almost completely resupinate, pealed off easily from the wood. The first photo is the dried specimen, the next two are dissection scope views. Cystidia are at 400X, spores at 1000X. Spores 7 X 11 (ave of 5), with a transparent outer part. Cystidia numerous, thickwalled, and incrusted with crystals. Clamp connections occasional. The ITS sequence is a nearly exact match:
AAGGATCATTAACGAGTCTTGAAAGGGTTGTAGCTGGCCTCCCGAGGCACGTGCACGCCCGCTCATCCGCTCTACACCTGTGCACCATTGTAGGTCGGTCGTGCGGGCGCCCCTCTTCTGGGGCGCTCGAGCGGTCTTCCTATGTAACACCACACACCATGCAGTATCGGAACGACGACGCGATAATACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAAACCCCTATCCCTTGTGGAGAGCGGGCTTGGACTTGGAGGCTTGCCGGCCGTCGTGGTCGGCTCCTCTCGAATGCATCAGCTCGATTCCTTGCGGATCGGCTCTCGGCGTGATAATTGTCTACGTCGTGACCGTGAAGCGTCTGGCGGGCTTCTAACCGTCCCTTCGAGGACAACCCTTCGAATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

Photos / Sounds

Observer

alan_rockefeller

Date

December 22, 2020 07:17 PM PST

Description

Stems and caps somewhat fluorescent in 365 nanometer ultraviolet light. Spores not so much, but young gills glow brightly.

Photos / Sounds

What

Western Jack-O'-Lantern (Omphalotus olivascens)

Observer

julietlee

Date

December 23, 2020 06:26 PM PST

Description

bioluminescent gills

Photos / Sounds

Date

October 2017

Description

Natural History of UCSC Campus, Fall 2017, Professor Ryan Carle

Photos / Sounds

What

Chuck-Will's-Widow (Antrostomus carolinensis)

Observer

whitetail14

Date

April 18, 2020 08:04 PM UTC

Place

Jamestown (Google, OSM)

Photos / Sounds

Observer

leptonia

Date

January 22, 2020 03:50 PM PST

Photos / Sounds

What

Midnight Entoloma (Entoloma medianox)

Observer

evangerardo

Date

January 30, 2020 11:30 AM PST

Photos / Sounds

What

Conifer Chicken of the Woods (Laetiporus conifericola)

Observer

maggief

Date

December 22, 2019 11:21 AM HST

Photos / Sounds

What

Ringtail (Bassariscus astutus)

Observer

rmyoshihara

Date

July 31, 2014 11:51 AM PDT

Description

Update on 1/27/2020:
The habitat was a wooded riparian strip along a levee adjacent to agricultural fields at the edge of the Sacramento Bypass Wildlife Area.

Three photos have been added

Photos / Sounds

What

Pinwheel Family (Family Marasmiaceae)

Observer

milavth

Date

December 15, 2019 11:16 AM PST

Photos / Sounds

What

Boletes (Family Boletaceae)

Observer

flygrl67

Date

December 2018

Description

When I cut it in half it quickly stained dark blue. Later that evening the blue disappeared, however it reappeared again when I scraped it with a knife. The odor and taste of both the cap and stipe were mild and indistinct. It was medium firm and was moist, but not at all slimy.

Photos / Sounds

Date

April 24, 2014 12:23 PM PDT

Photos / Sounds

What

San Joaquin Kit Fox (Vulpes macrotis ssp. mutica)

Observer

rkharwood

Date

April 2014

Description

A family of San Joaquin Kit foxes including an adult male and female with 6 pups was seen on 2 consecutive days. A photo is of a pup with a Yellow-rumped Warbler, Dendroica coronata.
Also photos of the adults, pups and a den.

Photos / Sounds

What

Threespine Stickleback (Gasterosteus aculeatus)

Observer

isaac_krone

Date

September 29, 2018 11:44 AM CDT

Photos / Sounds

What

Western Hardwood Sulphur Shelf (Laetiporus gilbertsonii)

Observer

kevinhintsa

Date

October 23, 2018 09:54 AM PDT

Description

Host plant is a Eucalyptus globulus .

Photos / Sounds

What

Western Hardwood Sulphur Shelf (Laetiporus gilbertsonii)

Observer

reinarau

Date

October 25, 2018 07:48 AM PDT

Photos / Sounds

What

Dyeball (Pisolithus arhizus)

Observer

milavth

Date

October 21, 2018 10:55 AM PDT

Photos / Sounds

What

Western Hardwood Sulphur Shelf (Laetiporus gilbertsonii)

Observer

katatat

Date

October 21, 2018 11:39 AM PDT

Photos / Sounds

What

Berkeley's Polypore (Bondarzewia berkeleyi)

Observer

eviloreo

Date

October 1, 2018 11:58 AM EDT

Description

In median in parking lot of apartment complex.

Photos / Sounds

What

Flattened Thornbush Lichen (Kaernefeltia merrillii)

Date

April 6, 2017 09:45 AM PDT

Photos / Sounds

What

Hillside Broomrape (Aphyllon vallicola)

Observer

catchang

Date

July 16, 2016 01:49 PM PDT

Photos / Sounds

What

Clustered Broomrape (Aphyllon fasciculatum)

Observer

ang

Date

May 24, 2017 12:26 PM PDT

Photos / Sounds

What

Clustered Broomrape (Aphyllon fasciculatum)

Observer

connerbridges

Date

April 28, 2018 12:06 PM PDT

Photos / Sounds

What

Clustered Broomrape (Aphyllon fasciculatum)

Observer

danceswithwolves

Date

April 28, 2018 01:10 PM PDT

Photos / Sounds

What

Clustered Broomrape (Aphyllon fasciculatum)

Observer

tiwane

Date

April 28, 2018 12:05 PM PDT

Photos / Sounds

What

Chaparral Broomrape (Aphyllon tuberosum)

Observer

rhjackso

Date

May 5, 2018 03:45 PM PDT

Photos / Sounds

What

North American River Otter (Lontra canadensis)

Observer

hailkeepur

Date

May 9, 2018 07:41 PM PDT

Photos / Sounds

Observer

pogon

Date

April 27, 2018 05:15 PM PDT

Description

On purple-leaf plum

Photos / Sounds

Observer

kueda

Date

April 28, 2018 09:17 PM PDT

Photos / Sounds

What

Common Poorwill (Phalaenoptilus nuttallii)

Observer

antnat

Date

April 28, 2018 10:18 PM PDT

Photos / Sounds

Observer

nmcnear

Date

April 2018

Photos / Sounds

Observer

damontighe

Date

April 27, 2018 09:56 PM PDT

Photos / Sounds

Observer

leptonia

Date

December 2010

Photos / Sounds

What

Gastropods (Class Gastropoda)

Observer

edoswalt

Date

February 4, 2018 11:01 AM PST

Description

Eggs like these were mostly scattered inch or more apart; this is a rare clump. Under (I think) cattail fronds in moist area (usually would have standing water this time of year). Each egg approx 2mm long.

Photos / Sounds

Observer

edoswalt

Date

April 23, 2014 01:46 PM PDT

Description

Let's consider this to be an observation of the lower spider; see other observation for the top spider.

Photos / Sounds

Observer

stephen_sikes

Date

November 26, 2017 11:13 AM PST

Description

Base of a Bay Tree

Photos / Sounds

Observer

pogon

Date

April 26, 2017 02:27 PM PDT

Description

In areas where pine had invaded Nothofagus forest

Photos / Sounds

Observer

moonlittrails

Date

December 9, 2017 05:07 PM PST

Description

Could this be A. asmodaeus (Bond, 2012: known only from type locality Mt. Diablo)?

Est. 2cm BL, found in oak/mixed duff by @leftcoastnaturalist. It was non-responsive, so dead (but soft/flexible) or doing a very good job at playing dead.
More photos at https://bugguide.net/node/view/1476644/bgimage

Tags

Photos / Sounds

Observer

dominic

Date

March 25, 2016

Description

Not sure on ID, but there were a couple of these guys.

Other Animals

Photos / Sounds

What

Animals (Kingdom Animalia)

Observer

hydrosteve

Date

August 12, 2017 11:58 AM PDT

Description

Possible cougar marks in the trail - in what was mud at the top of a steep ravine.

Photos / Sounds

Observer

erwilbongolan

Date

August 26, 2017

Description

Iridescent Green Skin.
Wings have a black frosty striped pattern.
Lower part abdomen moves and down to groom itself.
It is next to a road on an invasive berry plant.

Photos / Sounds

What

California Vole (Microtus californicus)

Observer

emjtca

Date

September 2, 2017 07:57 AM PDT

Description

So many of them!

Photos / Sounds

Observer

kueda

Date

October 16, 2013 09:29 PM PDT

Description

I suspect this is Promyrmekiaphila, but I can't really see the cymbium, let alone any dorsal spines thereupon.

Photos / Sounds

What

Dolloff Cave Spider (Meta dolloff)

Observer

leptonia

Date

August 2017

Photos / Sounds

What

Human (Homo sapiens)

Observer

leptonia

Date

August 29, 2017 06:55 PM PDT

Description

Found by Daniel Schmelter and co. on cave wall near "Main Hall"
http://i.imgur.com/fmWxoSa.jpg

"Tissue" sampled into CTAB.
Update/edit: I don't think this is fungal, or any other sort of living thing. I think it's glow-in-the dark latex/rubber/goo who-knows-what

Photos / Sounds

Observer

miketroll

Date

July 19, 2006

Photos / Sounds

What

California Vole (Microtus californicus)

Observer

accordiongordon

Date

August 21, 2017 11:54 AM PDT

Description

Found underneath log, along with several other voles.

Photos / Sounds

What

Common Patterned Ant-mimic Ground Spider (Sergiolus montanus)

Observer

dshamlet

Date

July 1, 2017 04:50 PM PDT

Photos / Sounds

What

Ichneumonid Wasps (Family Ichneumonidae)

Observer

michael_hodge

Date

August 22, 2017 09:07 AM CDT

Photos / Sounds

What

Duneobello (Agaricus zelleri)

Observer

leptonia

Date

May 1, 2016 08:01 AM PDT

Description

G. californicum, presumably

Photos / Sounds

What

Koch's Wolf Spider (Alopecosa kochi)

Observer

zorzal

Date

April 30, 2016 03:47 PM PDT

Photos / Sounds

What

Northern Pygmy-Owl (Glaucidium gnoma)

Observer

direbecca

Date

April 19, 2016

Photos / Sounds

Observer

leptonia

Date

April 7, 2016 10:27 AM PDT

Photos / Sounds

What

Zoropsid Spiders (Family Zoropsidae)

Observer

flygrl67

Date

March 2016

Description

This was on the ceiling inside my house right above where I work. It was about 2" wide, including its legs, so the main part of it was about 3/4". I photographed it right where it was found on the ceiling, and then my son trapped it in a plastic cup before relocating it outside, and I photographed it in the cup with a white paper towel in the background, which made the details stand out. I couldn't get a shot of its eyes straight on, but it looks from my angle above it in the cup that it had 8 evenly spaced eyes. @rjadams55 , is this a Liocranid? Are those long tarsal claws on its hind legs or not? I was looking at plate 29 on your book, and some of the spiders on that page look similar, but they seem like they are smaller than the one I saw. There's this spider that looks similar (hard to tell w/the quality of this photo) that was also seen in SLO: http://bugguide.net/node/view/488050

Tags

Photos / Sounds

What

Segmented Worms (Phylum Annelida)

Observer

sassafire

Date

February 3, 2016

Description

Found in the Mud Flats at Crab Cove; ~2 inches long.

Photos / Sounds

What

Blue Cheese Polypore (Cyanosporus caesius)

Observer

bluebird101

Date

January 24, 2016 01:39 PM PST

Description

What an awesome find

Photos / Sounds

What

Amanita Sect. Amanita (Section Amanita)

Observer

flygrl67

Date

January 2016

Description

Habitat: Roadside, Oak Woodland
Substrate: Duff
Cap: 5.5" (14 cm) h x.75" (2 cm) thick, plane, pale butter yellow, translucent, dry, striated at the margin, white warts, sparser toward the center, white flesh, did not discolor, mild smell
Gills: white, adnexed, no latex, no bruising
Stipe: 4" h (10 cm) x 1-1.75" (2.5-4.5 cm) thick solid white, smooth, dry, tapered at the top, pronounced basal bulb, looks like an egg cup (volva), no ring present, no bruising, mild smell, snapped like chalk, very short striations at the very top of stipe

Photos / Sounds

What

Bear Lentinus (Lentinellus ursinus)

Observer

damontighe

Date

January 22, 2016 03:11 PM PST

Photos / Sounds

Observer

flygrl67

Date

January 2015

Description

Records on Mushroom Observer of this specimen including spore data: http://goo.gl/vxiYz2

This substantial mushroom was about 7-10 cm high and wide. According to Christian Schwarz, who examined this under a microscope, this is the first record of the genus Entocybe in Santa Cruz county (at least on iNaturalist). Proposed names: Entocybe trachyospora, Entocybe trachyospora var. purpureoviolacea

Please see my original post on Mushroom Observer: http://mushroomobserver.org/observer/show_observation/197555

Photos / Sounds

What

Shelf Fungi (Order Polyporales)

Observer

deejay

Date

October 18, 2015

Description

Found growing on a possibly diseased plum tree.

Photos / Sounds

What

Onion Earthball (Scleroderma cepa)

Observer

damontighe

Date

October 3, 2015 09:54 AM PDT

Photos / Sounds

What

Spreading Rush (Juncus patens)

Date

June 1, 2014 02:06 PM PDT

Photos / Sounds

Observer

kueda

Date

June 4, 2015 07:28 PM PDT

Description

Tons of these under a log in a drier part of the marsh. Never seen so many. And are those pseudoscorpion eggs?

Photos / Sounds

What

California Turret Spider (Atypoides riversi)

Observer

kueda

Date

July 1, 2015 09:08 PM PDT

Description

This one used lichen in its turret construction, a choice that we endorsed whole-heartedly. Also, Trent is the best turret tickler ever.

Photos / Sounds

What

King Bolete (Boletus edulis)

Observer

jzzipkin

Date

June 27, 2015 08:42 AM PDT