leptonia's Favorites

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Echinodontium ballouii wasn't seen for 100 years until Larry Millman found it in an Atlantic White Cedar swamp. Larry took me to the site, (which I can't say where it is) and we found about a dozen of these again 4 years after the first visit.

On abandoned fire wood. Hidden against ground and adding and growing on debris. 4 pores per mm.
Bruising pinkish. Spores: 3.7-4 x 4.9-5.4 with drop. Basidia: up to 37 x 7.4 um with four sterigmata. Lots of cystidia with round and pointy ends. Pine Barrens.

Growing under Quercus agrifolia. Immediate blue bruising of flesh and pores. Cap-light tan (darkening with handling). Pores- light yellow, very small. Stipe- bulbous with narrowing at apex with yellowish top half, brownish bottom half, no reticulation seen. Distinct odor, mildly bitter taste.
Last photo in series shows much larger, older, decomposed fruit body growing within a couple feet away and likely the same species as this observation.