Photos / Sounds

What

Mount Diablo Buckwheat (Eriogonum truncatum)

Observer

kevinhintsa

Date

May 2022

Place

Private

Description

Contra Costa County , California . Known site , exact location not shown .

Photos / Sounds

What

Wood Oysterling (Deconica horizontalis)

Observer

luca_hickey

Date

December 17, 2019

Description

Interesting

Photos / Sounds

Observer

jlippert2218

Date

November 1, 2020 03:00 PM PST

Description

On cantharellus cascadensis. Located by Melissa Johnson-Ravare. T21S R5E Sec 36 NW4 3500 ft elevation

Photos / Sounds

Observer

yanivsegal

Date

March 2022

Place

Israel (Google, OSM)

Description

Calongea prieguensis

Photos / Sounds

Observer

luca_hickey

Date

September 27, 2020 10:10 AM PDT

Photos / Sounds

Observer

jgarciapelayohsu

Date

December 9, 2021 09:55 AM PST

Photos / Sounds

What

Humboldt County Milkvetch (Astragalus agnicidus)

Observer

betweenthelyons

Date

March 2022

Description

Lots in burn zone

Photos / Sounds

Date

March 2022

Description

Additional photos and close ups of main individual.

Photos / Sounds

What

Garden Arion (Arion hortensis)

Observer

corndog

Date

March 22, 2022 08:18 PM PDT

Photos / Sounds

What

Rose-flowered Larkspur (Delphinium purpusii)

Observer

morganstickrod

Date

March 2022

Photos / Sounds

Observer

riverahlquist

Date

March 17, 2022 01:38 PM CDT

Photos / Sounds

What

Degenerate Sawgill (Neolentinus degener)

Observer

lilcar

Date

June 5, 2021 04:53 PM CEST

Photos / Sounds

What

Baldwin's Clematis (Clematis baldwinii)

Observer

logancrees

Date

March 10, 2022 11:09 AM CST

Photos / Sounds

Observer

malacothrix

Date

January 15, 2022 11:54 AM PST

Description

SOMA foray

Found amongst Umbellularia californica and Psuedotsuga menziesii with scattered Quercus agrifolia nearby

Photos / Sounds

What

Peacock Mantis Shrimp (Odontodactylus scyllarus)

Observer

jennykeeping

Date

December 20, 2018 05:55 AM SAST

Photos / Sounds

Observer

ymwang

Date

February 1, 2022 11:13 AM UTC

Photos / Sounds

Observer

ymwang

Date

February 18, 2022 03:38 PM PST

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Observer

lizziepop

Date

January 30, 2009

Description

Bulbous Mushroom


Ball shaped cap when young and purple-pinkish colour. Becoming flat and caramel brown, Bulbous clavate stem, creamy lamellae,cap diameter 4-5,5cm, height 5cm, bulb diameter 3-4,5cm, growing under Tipiana

Tags

Photos / Sounds

What

Amanita Sect. Lepidella (Section Lepidella)

Observer

stucumber_

Date

February 10, 2019 02:48 PM PST

Photos / Sounds

Observer

biocowboy

Date

March 4, 2022 01:47 PM PST

Photos / Sounds

What

Blue-breasted Kingfisher (Halcyon malimbica)

Observer

nikborrow

Date

January 31, 2022

Photos / Sounds

Observer

dannymi

Date

November 5, 2018

Photos / Sounds

What

Gulf Signal Blenny (Emblemaria hypacanthus)

Date

October 2011

Photos / Sounds

Observer

garmonb0zia

Date

March 21, 2019 12:27 PM PDT

Description

Growing on ericameria stem, strongly farinaceous odor.

Photos / Sounds

Observer

chloe_and_trevor

Date

January 8, 2022 06:16 PM PST

Photos / Sounds

What

Desert Inkcap (Montagnea arenaria)

Observer

melsocal

Date

February 21, 2022 10:42 AM PST

Photos / Sounds

Observer

fungee

Date

July 2019

Description

red oak, hemlock, yellow birch

Tags

c7

Photos / Sounds

What

Pine Trogossitid Beetle (Temnoscheila chlorodia)

Observer

andesgascon_alex

Date

April 6, 2020

Photos / Sounds

What

Sonoma Canescent Manzanita (Arctostaphylos canescens ssp. sonomensis)

Observer

morganstickrod

Date

November 2020

Photos / Sounds

What

Decorated Pholiota (Leucopholiota decorosa)

Observer

danielle775

Date

August 25, 2021 08:06 AM UTC

Description

Growing on decomposing White Birch

Photos / Sounds

What

Hairy Oyster Mushroom (Panus lecomtei)

Observer

chelseamcd

Date

May 19, 2020

Place

Castlegar (Google, OSM)

Photos / Sounds

What

Veiled Panus (Tectella patellaris)

Observer

autumna

Date

November 15, 2020 01:48 PM PST

Description

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Photos / Sounds

What

Shelf Fungi (Order Polyporales)

Observer

chuckie1997

Date

October 24, 2020 07:13 PM PDT

Place

Beaverton (Google, OSM)

Photos / Sounds

Observer

brettjackson

Date

February 17, 2022 02:09 PM CST

Description

On the underside of Quercus pagoda leaf. A few alate individuals present.

White coloring nearby is probably the mycelial mat formed by Erysiphe abbreviata, often found hypophyllous on Q. pagoda .

Photos / Sounds

What

Star-flowered Lily-of-the-Valley (Maianthemum stellatum)

Observer

leptonia

Date

May 29, 2020 09:15 AM PDT

Tags

Photos / Sounds

Observer

tmurray74

Date

March 2014

Description

Echinodontium ballouii wasn't seen for 100 years until Larry Millman found it in an Atlantic White Cedar swamp. Larry took me to the site, (which I can't say where it is) and we found about a dozen of these again 4 years after the first visit.

Photos / Sounds

Observer

dwborland

Date

July 28, 2013 06:12 PM EDT

Description

Leucopaxillus gracillimus.0182.7.28.13.dwb/alachua co. florida

rather uncommon

syn. Clitocybe rappiana

Photos / Sounds

Date

March 5, 2017 09:21 AM PST

Photos / Sounds

Observer

kschnei

Date

April 18, 2019 11:44 AM PDT

Description

Tiny 1-mm springtail swept from grasses and collected temporarily for photomicrographs.

Photos / Sounds

What

Ceiba Borer (Euchroma giganteum)

Observer

rtshaw80

Date

March 27, 2015 10:56 AM CDT

Photos / Sounds

What

Western Basilisk (Basiliscus galeritus)

Observer

rtshaw80

Date

March 24, 2015 12:33 PM CDT

Photos / Sounds

What

Greater Sac-winged Bat (Saccopteryx bilineata)

Observer

rtshaw80

Date

March 24, 2015 08:06 AM CDT

Photos / Sounds

Observer

dgreenberger

Date

February 6, 2022 04:51 PM PST

Photos / Sounds

What

Thalassica Grasshopper (Trimerotropis thalassica)

Observer

panarthropodism

Date

April 18, 2021 02:24 PM EDT

Photos / Sounds

Observer

alison_pollack

Date

February 4, 2022 03:35 PM HST

Description

I was thrilled when @graysquirrel found these as we were poking around the woods together! Such a beautiful species!

Photos / Sounds

Observer

kdff

Date

January 28, 2022

Description

On Toyon berries, Heteromeles arbutifolia.

Photos / Sounds

Observer

mycotrope

Date

May 30, 2015 02:28 PM PDT

Tags

Photos / Sounds

What

Merten's Chiton (Lepidozona mertensii)

Observer

kestrel

Date

January 30, 2022 03:31 PM PST

Photos / Sounds

Observer

colinpurrington

Date

July 25, 2017 04:01 PM EDT

Description

On Dacrymyces (I think).

Photos / Sounds

Observer

wangchuk

Date

August 22, 2021 09:35 AM +06

Description

Alpine screes

Photos / Sounds

Observer

malacothrix

Date

December 10, 2021 12:41 PM PST

Photos / Sounds

Observer

betweenthelyons

Date

January 21, 2022 03:52 PM UTC

Photos / Sounds

Observer

spencer_wimmer

Date

July 25, 2021 01:42 PM MDT

Photos / Sounds

What

Paiute Sculpin (Cottus beldingii)

Observer

faerthen

Date

May 19, 2018 12:13 PM PDT

Description

Turned him up cleaning the glass. This is the biggest sculpin I've ever seen in the creek, though the camera lens wants to make my fingers look bigger than they are relative to the fish.

Photos / Sounds

What

Rockhead (Bothragonus swanii)

Observer

crabsandshrimps

Date

July 13, 2010 08:05 AM PDT

Photos / Sounds

What

Rockhead (Bothragonus swanii)

Observer

alex_bairstow

Date

January 20, 2019 05:01 PM PST

Photos / Sounds

Observer

chloe_and_trevor

Date

December 26, 2021 12:59 PM PST

Photos / Sounds

Observer

damontighe

Date

May 27, 2019 09:57 AM PDT

Photos / Sounds

Observer

kueda

Date

February 12, 2021 10:32 AM PST

Description

Found several under rocks and logs on a rocky, grassy hillside, maybe 1-2 mm long, fairly active. I think these should be called candy cane mites or Christmas mites.

Photos / Sounds

What

Guernsey Shipworm (Lyrodus pedicellatus)

Observer

thomaseverest

Date

December 29, 2017

Description

In beached driftwood, third photo is young found brooding in the gills of larger individuals

Photos / Sounds

What

Webcaps (Genus Cortinarius)

Observer

flygrl67

Date

January 2022

Description

Chartreuse colored cap, bulb, and mycelial threads; reddish brown discolorations on cap; olivaceus-black KOH rxn on cap

Photos / Sounds

What

Brittlegills (Genus Russula)

Observer

flygrl67

Date

January 2022

Photos / Sounds

Observer

imlichentoday

Date

September 16, 2021 10:00 AM PDT

Description

Garden Spot East Anacapa ~25ft

Photos / Sounds

What

Greater Argonaut (Argonauta argo)

Observer

mzuckerfish

Date

October 2021

Photos / Sounds

What

Limbaugh's Cadlina (Cadlina limbaughorum)

Observer

uwkwaj

Date

November 27, 2021 10:35 AM PST

Photos / Sounds

Observer

maricel-patino

Date

December 11, 2021 02:25 AM EST

Description

On abandoned fire wood. Hidden against ground and adding and growing on debris. 4 pores per mm.
Bruising pinkish. Spores: 3.7-4 x 4.9-5.4 with drop. Basidia: up to 37 x 7.4 um with four sterigmata. Lots of cystidia with round and pointy ends. Pine Barrens.

Photos / Sounds

What

Golden Snow Flea (Hymenaphorura cocklei)

Observer

dr_q

Date

June 27, 2019 02:59 PM PDT

Description

Not an insect! Springtails are a different Class. This particular springtail is a golden snowflea.

Photos / Sounds

Observer

dlbowls

Date

January 2017

Description

The orange ones. Our ID is based on comparison to pictures on Bugguide.net. We are hoping for confirmation from them.

Photos / Sounds

Observer

glmory

Date

February 16, 2017 06:50 PM PST

Photos / Sounds

What

Bear-bodied Springtail (Neanura magna)

Observer

cedric_lee

Date

March 4, 2017 11:09 AM PST

Photos / Sounds

What

Nudibranch-mimicking Amphipod (Podocerus cristatus)

Observer

divindk

Date

April 25, 2021 10:04 AM PDT

Description

Podocerus cristatus amphipod at Santa Cruz Island, CA. Depth 60' / 20M. Water temp 50 degrees F

Photos / Sounds

Observer

sea-kangaroo

Date

October 19, 2018 09:20 AM PDT

Description

Dive site Emerald Cove, max depth 61ft/19m.

Decently large (~4" diameter) solitary anemone.

Photos / Sounds

What

Red-Headed Aeolid (Noumeaella rubrofasciata)

Observer

uwkwaj

Date

November 13, 2021

Description

With egg masses

Photos / Sounds

What

Fish Isopods (Family Cymothoidae)

Observer

socal_angling

Date

January 9, 2022 10:48 AM UTC

Description

Parasitic isopod on the tail of a white surfperch

Photos / Sounds

Observer

jonaleef

Date

August 2021

Photos / Sounds

What

Seaweed Isopod (Pentidotea stenops)

Observer

dgreenberger

Date

January 2021

Photos / Sounds

What

Cockscomb Nudibranch (Antiopella barbarensis)

Observer

mcduck

Date

September 15, 2015

Description

27mm length. Second photo is close-up of rhinophore. Specimen at CASIZ 208937.

Photos / Sounds

What

Orange-spike Polycera (Polycera atra)

Observer

anudibranchmom

Date

June 2016

Photos / Sounds

What

Red-trumpet Calcareous Tubeworm (Serpula columbiana)

Observer

leslieh

Date

November 14, 2021

Description

inverts from RV Yellowfin cruise_Dr. Kimo Morris' marine biology class

Photos / Sounds

Observer

zabbey

Date

March 7, 2019 10:45 AM PST

Description

Verrucaria?

Photos / Sounds

What

Bloody-heart Lichen (Mycoblastus sanguinarius)

Observer

gnomewardbound

Date

March 13, 2021 03:16 PM PST

Photos / Sounds

What

Woven-spored Microlichen (Texosporium sancti-jacobi)

Date

April 2018

Photos / Sounds

What

Methuselah's Beard Lichen (Usnea longissima)

Observer

kkellman

Date

December 2019

Photos / Sounds

What

Blushing Scale (Psora decipiens)

Observer

susanmf

Date

March 22, 2021 10:56 AM PDT

Photos / Sounds

What

Blind Goby (Typhlogobius californiensis)

Observer

acastelein

Date

January 5, 2022 06:24 PM PST

Photos / Sounds

What

Rosy Sculpin (Oligocottus rubellio)

Observer

acastelein

Date

January 5, 2022 06:33 PM PST

Photos / Sounds

What

California Newt (Taricha torosa)

Observer

naturecandids

Date

January 2, 2022 12:51 PM PST

Description

There were hundreds of these fellows in a small, seasonal pond (last photo).

Photos / Sounds

What

Yellow Monardella (Monardella nana)

Observer

squamatologist

Date

June 5, 2008 12:09 PM CDT

Description

Little Monardella (Monardella nana), eastern San Diego County, California

Photos / Sounds

Observer

robertdavis

Date

September 25, 2019 08:42 AM PDT

Description

Host mushroom chanterelle, found in the coast range of Oregon. Research and suggestions led to entoloma parasiticum as the most likely candidate.

Photos / Sounds

What

Aspen Oyster Mushroom (Pleurotus populinus)

Observer

traceurcameron

Date

December 28, 2020 02:15 PM UTC

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Observer

terryleecrane

Date

October 14, 2004 02:30 PM CDT

Photos / Sounds

Observer

dietel

Date

December 21, 2021 07:15 PM PST

Description

Modified by CombineZP

Photos / Sounds

What

Wilson's Snipe (Gallinago delicata)

Observer

glosterbirder

Date

October 16, 2017 03:26 PM BST

Description

Right hand bird in photos with Common Snipe.

Photos / Sounds

Observer

imlichentoday

Date

December 7, 2021 07:00 PM PST

Description

Low tide. Shot from above and below water.

Photos / Sounds

Observer

theoneje

Date

July 1, 2021 02:44 PM HST

Description

oh M. polymorpha

Photos / Sounds

What

Ben's Bitter Bolete (Caloboletus marshii)

Observer

ctrubo

Date

December 2021

Description

Growing under Quercus agrifolia. Immediate blue bruising of flesh and pores. Cap-light tan (darkening with handling). Pores- light yellow, very small. Stipe- bulbous with narrowing at apex with yellowish top half, brownish bottom half, no reticulation seen. Distinct odor, mildly bitter taste.
Last photo in series shows much larger, older, decomposed fruit body growing within a couple feet away and likely the same species as this observation.

Photos / Sounds

What

Grasshopper Buzzard (Butastur rufipennis)

Observer

nikborrow

Date

November 24, 2021

Photos / Sounds

Observer

ymwang

Date

October 4, 2021 02:36 PM PDT

Photos / Sounds

What

Rustgills and Gyms (Genus Gymnopilus)

Observer

maricel-patino

Date

November 25, 2021 02:15 AM EST

Description

Tiny creamy caps on buried stick. Mixed woods. Park. Cheilocystidia with capitate ends and irregularly constricted. Clamps present. Spores brown, with apiculus and thick walls: 6.1 x 9.3-9.8 um. Cheilocystidia: up to 61 um long and 14.8 um when capitate. Manuel Villarreal also proposed Simocybe sumptuosa. https://eol.org/pages/194724