Photos / Sounds

What

Bird's Nest Fungi (Family Nidulariaceae)

Observer

johnplischke

Date

August 8, 2022 10:30 AM EDT

Photos / Sounds

What

Eastern Chimpanzee (Pan troglodytes ssp. schweinfurthii)

Observer

toutterrain

Date

April 2013

Place

Uganda (Google, OSM)

Photos / Sounds

What

Eastern Chimpanzee (Pan troglodytes ssp. schweinfurthii)

Observer

toutterrain

Date

March 2013

Place

Uganda (Google, OSM)

Photos / Sounds

What

White Peacock (Anartia jatrophae)

Observer

dandkforever

Date

June 29, 2022 05:19 PM EDT

Photos / Sounds

What

Malabar Slender Loris (Loris lydekkerianus ssp. malabaricus)

Observer

vishwanathgowda

Date

June 2022

Description

Found this on lower branch of wild tree. Night macro walk.

Photos / Sounds

What

One-flowered Cancer-Root (Aphyllon uniflorum)

Observer

ana_kaahanui

Date

April 30, 2022 12:35 PM EDT

Photos / Sounds

What

Black-tailed Red Sheetweaver (Florinda coccinea)

Observer

bugzilla

Date

August 28, 2021 07:51 AM EDT

Description

One of dozens of webs glistening in the morning dew.

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Observer

snowmanstudios

Date

February 15, 2022 09:27 PM UTC

Description

taken during travels to Sri Lanka in 2022 - taken by Thomas Fuhrmann, SnowmanStudios - see more pictures on www.snowmanstudios.de

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Observer

snowmanstudios

Date

February 15, 2022 08:27 PM UTC

Description

taken during travels to Sri Lanka in 2022 - taken by Thomas Fuhrmann, SnowmanStudios - see more pictures on www.snowmanstudios.de

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Observer

anoopnair747

Date

March 14, 2021 09:32 PM UTC

Description

Rescued this beautiful creature from a owl and released in a suitable habitat

Photos / Sounds

What

Bornean Orangutan (Pongo pygmaeus)

Observer

michal243

Date

April 2013

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Observer

aravindmanoj

Date

January 22, 2022

Place

Dindigul (Google, OSM)

Photos / Sounds

What

Bornean Orangutan (Pongo pygmaeus)

Observer

michal243

Photos / Sounds

What

Snowy Owl (Bubo scandiacus)

Observer

mattyfelp

Date

January 6, 2022 09:58 PM EST

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Observer

murugeshgeo

Date

August 2021

Photos / Sounds

What

Bornean Orangutan (Pongo pygmaeus)

Observer

budak

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Date

May 28, 2011 04:57 PM IST

Description

Observer: Sanjeev Kumar

Photos / Sounds

What

Orange Assassin Bug (Pselliopus barberi)

Observer

valehu

Date

May 2021

Photos / Sounds

What

Fleabanes and Horseweeds (Genus Erigeron)

Observer

rundvm1

Date

April 30, 2021 11:08 AM EDT

Photos / Sounds

What

Dark-eyed Junco (Junco hyemalis)

Observer

carrieseltzer

Date

February 21, 2021 01:40 PM EST

Photos / Sounds

What

Northeast Bornean Orangutan (Pongo pygmaeus ssp. morio)

Observer

alphaj16

Date

August 2018

Photos / Sounds

What

Gold Dust Day Gecko (Phelsuma laticauda)

Observer

maryeford

Date

October 2, 2014 02:15 PM EDT

Photos / Sounds

Observer

maryeford

Date

October 12, 2015 03:24 PM EDT

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Observer

danielraju

Date

March 15, 2017

Photos / Sounds

What

Grey Slender Loris (Loris lydekkerianus)

Observer

ronithurs

Date

June 25, 2020 08:30 AM IST

Description

Found a pair of Grey Slender Loris hiding in the thick canopy of a tree, got decent views

Photos / Sounds

What

Bornean Orangutan (Pongo pygmaeus)

Observer

gery-dupas

Date

November 2015

Photos / Sounds

What

Spicebush Swallowtail (Papilio troilus)

Observer

carrieseltzer

Date

May 2020

Description

Well, this is one of the stranger wildlife interactions I’ve had in my yard. I’m sitting out here working with my laptop and a bag of M&Ms and this butterfly flies towards me and goes straight for the bag. I stare in disbelief as it climbs in, fumble for my phone, and snap a few shots before it climbs out and flies away.

Photos / Sounds

What

Violet Carpenter Bee (Xylocopa violacea)

Observer

snek_with_arms

Date

August 19, 2016 02:22 PM CEST

Photos / Sounds

What

White-spotted Slimy Salamander (Plethodon cylindraceus)

Observer

graytreefrog

Date

April 2020

Description

First record of this species in Arlington County since 1977. Adult female found under a log in an upland area dominated by mountain laurel, similar to the habitat I’ve found this species in elsewhere in northern Virginia. This was in a park that has been extensively surveyed, yet there aren’t even any historical records of this species from this park. Absolutely amazing to find this species somewhere it has gone undetected for all this time.

Photos / Sounds

What

White-tailed Deer (Odocoileus virginianus)

Observer

jamesdunbar

Date

May 15, 2019 09:23 AM UTC

Photos / Sounds

What

Southwest Bornean Orangutan (Pongo pygmaeus ssp. wurmbii)

Observer

cccrll

Date

July 2014

Photos / Sounds

What

Red-bellied Woodpecker (Melanerpes carolinus)

Observer

jamesspitznas

Date

September 19, 2019 08:31 AM EDT

Photos / Sounds

What

California Ground Squirrel (Otospermophilus beecheyi)

Observer

jamesspitznas

Date

August 9, 2010 08:46 AM EDT

Photos / Sounds

What

White-tailed Kite (Elanus leucurus)

Observer

jamesspitznas

Date

August 9, 2010 05:45 PM EDT

Photos / Sounds

What

California Sea Lion (Zalophus californianus)

Observer

jamesspitznas

Date

January 28, 2011 02:51 PM EST

Photos / Sounds

What

Red Knot (Calidris canutus)

Observer

jamesspitznas

Date

January 28, 2011 03:57 PM EST

Photos / Sounds

What

Vesper Sparrow (Pooecetes gramineus)

Observer

jamesspitznas

Date

September 10, 2010 08:13 AM EDT

Description

Vesper Sparrow - Pooecetes gramineus

Photos / Sounds

What

Pato Havelda (Clangula hyemalis)

Observer

jamesspitznas

Date

January 1, 2020 10:22 AM EST

Description

Long-tailed Duck (male, non-breeding) - Clangula hyemalis

Photos / Sounds

What

American Wigeon (Mareca americana)

Observer

jamesspitznas

Date

January 1, 2020 12:12 PM EST

Description

American Wigeon Duck - Anas americana

Photos / Sounds

What

Song Sparrow (Melospiza melodia)

Observer

jamesspitznas

Date

September 29, 2019 07:52 AM EDT

Photos / Sounds

What

Allen's Hummingbird (Selasphorus sasin)

Observer

jamesspitznas

Date

November 3, 2019 11:39 AM EST

Photos / Sounds

Observer

acmicrobiology

Date

December 3, 2019 02:12 PM EST

Description

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Photos / Sounds

Observer

acmicrobiology

Date

December 3, 2019 02:12 PM EST

Description

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Photos / Sounds

What

Chorlito Gris (Pluvialis squatarola)

Observer

jamesspitznas

Date

November 2, 2019 08:29 PM EDT

Description

Black-bellied Plover (non-breeding) - Pluvialis squatarola

Photos / Sounds

What

Killdeer (Charadrius vociferus)

Observer

jamesspitznas

Date

November 3, 2019 02:14 PM EST

Photos / Sounds

What

Western Grebe (Aechmophorus occidentalis)

Observer

jamesspitznas

Date

November 3, 2019 11:12 AM EST

Photos / Sounds

What

Pied-billed Grebe (Podilymbus podiceps)

Observer

jamesspitznas

Date

November 3, 2019 11:07 AM EST

Photos / Sounds

What

Martinete Común (Nycticorax nycticorax)

Observer

jamesspitznas

Date

November 8, 2019 11:06 AM EST

Photos / Sounds

What

Martinete Común (Nycticorax nycticorax)

Observer

jamesspitznas

Date

November 7, 2019 08:41 PM EST

Place

Lindo Lake (Google, OSM)

Photos / Sounds

What

Martinete Común (Nycticorax nycticorax)

Observer

jamesspitznas

Date

November 7, 2019 07:57 PM EST

Place

Lindo Lake (Google, OSM)

Photos / Sounds

What

Martinete Común (Nycticorax nycticorax)

Observer

jamesspitznas

Date

November 3, 2019 11:23 AM EST

Photos / Sounds

What

House Geckos (Genus Hemidactylus)

Observer

aphaywood

Date

November 18, 2019 11:35 AM IST

Photos / Sounds

What

Great Blue Heron (Ardea herodias)

Observer

jamesspitznas

Date

November 2, 2019 07:38 PM EDT

Photos / Sounds

What

Reddish Egret (Egretta rufescens)

Observer

jamesspitznas

Date

November 8, 2019 11:58 AM EST

Photos / Sounds

What

Northern Walkingstick (Diapheromera femorata)

Observer

jamesspitznas

Date

August 27, 2019 05:01 AM EDT

Photos / Sounds

What

Eastern Kingbird (Tyrannus tyrannus)

Observer

jamesspitznas

Date

July 26, 2019 08:33 AM EDT

Description

Eastern Kingbird [Flycatcher] - Tyrannus tyrannus

Photos / Sounds

What

Green Heron (Butorides virescens)

Observer

jamesspitznas

Date

July 26, 2019 08:30 AM EDT

Photos / Sounds

What

Green Heron (Butorides virescens)

Observer

jamesspitznas

Date

July 26, 2019 09:57 AM EDT

Description

Green Heron - Butorides virescens

Photos / Sounds

What

Red-winged Blackbird (Agelaius phoeniceus)

Observer

jamesspitznas

Date

July 26, 2019 08:16 AM EDT

Photos / Sounds

What

Leopard Slug (Limax maximus)

Observer

jamesspitznas

Date

July 3, 2019 05:03 AM EDT

Photos / Sounds

What

Tree Swallow (Tachycineta bicolor)

Observer

jamesspitznas

Date

April 21, 2019 09:46 AM EDT

Photos / Sounds

What

Eastern Towhee (Pipilo erythrophthalmus)

Observer

jamesspitznas

Date

June 27, 2019 04:26 PM EDT

Photos / Sounds

What

Eastern Bluebird (Sialia sialis)

Observer

jamesspitznas

Date

May 24, 2019 09:45 AM EDT

Description

Eastern Bluebird (female) - Sialia sialis

Photos / Sounds

What

Eastern Bluebird (Sialia sialis)

Observer

jamesspitznas

Date

May 24, 2019 09:15 AM EDT

Description

Eastern Bluebird (male) - Sialia sialis

Photos / Sounds

What

Common Tern (Sterna hirundo)

Observer

congonaturalist

Date

June 18, 2019 12:05 PM EDT

Description

Catching a fish

Photos / Sounds

What

Common Snapping Turtle (Chelydra serpentina)

Observer

jamesspitznas

Date

May 24, 2019 08:27 AM EDT

Photos / Sounds

What

African Leopard (Panthera pardus ssp. pardus)

Observer

evan81

Date

April 2019

Photos / Sounds

What

Swallow-tailed Kite (Elanoides forficatus)

Observer

alyssacritters

Date

April 2019

Description

Heard the kite smack into a tree branch and didn't realize what it was doing until it dropped this guy from above!

Photos / Sounds

What

Great Blue Heron (Ardea herodias)

Observer

jamesspitznas

Date

April 21, 2019 09:01 AM EDT

Photos / Sounds

What

Ovenbird (Seiurus aurocapilla)

Observer

jamesspitznas

Date

April 21, 2019 10:27 AM EDT

Photos / Sounds

What

Brown-headed Cowbird (Molothrus ater)

Observer

jamesspitznas

Date

April 21, 2019 08:13 AM EDT

Photos / Sounds

What

Tree Swallow (Tachycineta bicolor)

Observer

jamesspitznas

Date

March 31, 2019 06:26 PM EDT

Photos / Sounds

What

Common Loon (Gavia immer)

Observer

jamesspitznas

Date

March 31, 2019 07:01 PM EDT

Photos / Sounds

What

Canada Goose (Branta canadensis)

Observer

jamesspitznas

Date

March 31, 2019 06:46 PM EDT

Photos / Sounds

What

Tortuga de Florida (Trachemys scripta)

Observer

jamesspitznas

Date

April 1, 2019 05:23 PM EDT

Photos / Sounds

What

Virginia Bluebells (Mertensia virginica)

Observer

jamesspitznas

Date

April 3, 2019 05:36 PM EDT

Photos / Sounds

What

Anhinga (Anhinga anhinga)

Observer

carrieseltzer

Date

March 29, 2019 05:21 PM EDT

Photos / Sounds

What

Wood Duck (Aix sponsa)

Observer

jamesspitznas

Date

March 1, 2019 08:59 PM EST

Photos / Sounds

What

Snowy Egret (Egretta thula)

Observer

jamesspitznas

Date

February 25, 2019 09:29 PM EST

Tags

Photos / Sounds

What

Martinete Común (Nycticorax nycticorax)

Observer

jamesspitznas

Date

February 25, 2019 09:12 PM EST

Description

Black-crowned Night-Heron - Nycticorax nycticorax

Photos / Sounds

What

Purple Gallinule (Porphyrio martinica)

Observer

tomdriscoll

Date

February 14, 2019 10:40 AM EST

Photos / Sounds

What

Henderson's Shooting Star (Primula hendersonii)

Observer

rhjackso

Date

February 28, 2019 03:24 PM PST

Photos / Sounds

What

Short-billed Dowitcher (Limnodromus griseus)

Date

May 10, 2015 02:25 PM EDT

Photos / Sounds

What

Black-backed Oriole (Icterus abeillei)

Observer

manuelbecerril

Date

January 4, 2019

Place

Tlalpan (Google, OSM)

Description

Macho.

Photos / Sounds

What

Yellow-rumped Warbler (Setophaga coronata)

Observer

uzun

Date

January 4, 2019 09:25 AM PST

Photos / Sounds

What

Yellow-rumped Warbler (Setophaga coronata)

Observer

mattk561

Date

December 13, 2018 09:06 AM PST

Description

Bobelaine Sanctuary

Photos / Sounds

What

Eastern Bluebird (Sialia sialis)

Observer

jamesspitznas

Date

December 1, 2018 09:31 AM EST

Photos / Sounds

What

Red-bellied Woodpecker (Melanerpes carolinus)

Observer

jariemames

Date

November 27, 2018 11:01 AM EST

Photos / Sounds

What

Palm Warbler (Setophaga palmarum)

Observer

jariemames

Date

November 27, 2018 11:03 AM EST

Photos / Sounds

What

Martinete Común (Nycticorax nycticorax)

Observer

avocat

Date

November 3, 2018 04:48 PM PDT

Photos / Sounds

What

Perplexing Bumble Bee (Bombus perplexus)

Observer

bob15noble

Date

July 30, 2018 01:16 PM EDT

Photos / Sounds

What

Eastern Bluebird (Sialia sialis)

Observer

jamesspitznas

Date

September 3, 2018 09:33 AM EDT

Description

Eastern Bluebird [Thrush] - Sialia sialis

Photos / Sounds

What

Least Sandpiper (Calidris minutilla)

Observer

wayne_fidler

Date

August 29, 2018 12:26 PM EDT

Photos / Sounds

What

Blue-gray Tanager (Thraupis episcopus)

Observer

kenchamberlain

Date

January 31, 2015 05:36 AM PST

Photos / Sounds

What

Red-legged Honeycreeper (Cyanerpes cyaneus)

Observer

kenchamberlain

Date

January 31, 2015 05:44 AM PST

Photos / Sounds

What

Flame-colored Tanager (Piranga bidentata)

Observer

kenchamberlain

Date

January 31, 2015 05:32 AM PST

Photos / Sounds

What

Flame-colored Tanager (Piranga bidentata)

Observer

kenchamberlain

Date

January 31, 2015 11:21 AM PST

Photos / Sounds

What

Northern Mockingbird (Mimus polyglottos)

Observer

kalamurphyking

Date

September 29, 2015 01:51 PM CDT

Description

Photo 1: Mockingbirds don't eat my birdseed but they love my bird bath.
Photo 2: I was being very still but this look happened when one of my cats jumped up on the window sill to see what was out there. Check out the tiny little water drops on the tail.
Photo 3: In the middle of the bath it just sat and soaked for a minute.
Photo 4: This was taken a moment before it flew up into a tree to preen and dry off.

Photos / Sounds

What

American Bison (Bison bison)

Observer

brenbarr

Date

July 19, 2018 07:59 AM MDT

Photos / Sounds

What

Cedar Waxwing (Bombycilla cedrorum)

Observer

dpdawes

Date

July 1, 2018 07:13 PM EDT