Fotos / Sonidos

Observ.

iainmwalker

Fecha

Julio 21, 2023 a las 04:00 TARDE EDT

Descripción

I have a few specimens of the small fruiting bodies stored in a vial but I left the main specimen in the area that it was naturally growing

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Febrero 19, 2024 a las 07:13 TARDE CST

Descripción

Podospora millespora

https://www.speciesfungorum.org/Names/SynSpecies.asp?RecordID=337415

Black perithecia growing on incubated dung of Sylvilagus floridanus

Perithecial necks totally glabrous

Asci saccate, basally tapered, and appearing to house 1024 spores based on estimation and literature. Seems possible these are only 512 spored asci but those species did not match macroscopically.

Immature spores blue en masse!
Mature spores nearly black in color
Apical caudle scraggly and crooked, basal caudle is the same.

Got to species using this key

https://www.researchgate.net/profile/Francesco-Doveri/publication/259495621_A_bibliography_of_Podospora_and_Schizothecium_a_key_to_the_species_and_a_description_of_Podospora_dasypogon_newly_recorded_from_Italy/links/02e7e52c45f75e01d0000000/A-bibliography-of-Podospora-and-Schizothecium-a-key-to-the-species-and-a-description-of-Podospora-dasypogon-newly-recorded-from-Italy.pdf?origin=publication_detail&_tp=eyJjb250ZXh0Ijp7ImZpcnN0UGFnZSI6InB1YmxpY2F0aW9uIiwicGFnZSI6InB1YmxpY2F0aW9uRG93bmxvYWQiLCJwcmV2aW91c1BhZ2UiOiJwdWJsaWNhdGlvbiJ9fQ

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Observ.

taigamushrooms

Fecha

Septiembre 25, 2023 a las 02:34 TARDE EDT

Fotos / Sonidos

Observ.

mgkoons

Fecha

Agosto 7, 2023 a las 04:49 TARDE PDT

Descripción

Coprinellus 'PNW 04' growing completely submerged in flowing water on various small pieces of wood. I have no reason to think the water level here has recently risen, in a spring and summer long stream of snowmelt directly below a culvert in a considerable current, we haven't had any significant hot streak that would have raised the flow.

Overmature and mature clusters collected. Bases of the stipe seemed to have a "holdfast" adaptation at the base similar Vibrissea, see pictures. (I know they are in a different order, more of a visual metaphor)

Fotos / Sonidos

Observ.

alexgraeff

Fecha

Febrero 2024

Fotos / Sonidos

Observ.

heidi2

Fecha

Octubre 1, 2023

Fotos / Sonidos

Observ.

huafang

Fecha

Julio 15, 2023 a las 10:37 MAÑANA EDT

Fotos / Sonidos

Observ.

huafang

Fecha

Julio 13, 2023 a las 01:47 TARDE EDT

Fotos / Sonidos

Observ.

huafang

Fecha

Julio 13, 2023 a las 02:22 TARDE EDT

Fotos / Sonidos

Observ.

fungifern

Fecha

Octubre 6, 2023 a las 01:15 TARDE CDT

Fotos / Sonidos

Observ.

huafang

Fecha

Julio 13, 2023 a las 12:58 TARDE EDT

Fotos / Sonidos

Observ.

ashleywold

Fecha

Diciembre 9, 2023 a las 11:23 MAÑANA CST

Fotos / Sonidos

Observ.

rangersara

Fecha

Septiembre 14, 2017 a las 04:13 TARDE EDT

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Observ.

fungee

Fecha

Septiembre 7, 2017 a las 09:58 MAÑANA EDT

Fotos / Sonidos

Observ.

jackjohnsonn

Fecha

Febrero 7, 2024 a las 11:42 MAÑANA CST

Descripción

On Collybia nuda or Collybia brunneocephala, perethecial parasite on agaric. Spores echinulate, dark spored.
Update with microscopic characters
-->
Spores of multiple types present. All dark and echinulate, but septations varying from aseptate, singly septate, 1-2 septate, and then multi septate spores present which I think are from another species, perhaps an Alternaria. Frequently constricted at the central septation.
Most spores elliptic with a narrowed point of attachment.
Hyphae 4.7-5.5, septate, with irregular bulges. Septations regular in the vegetative growth, more sparse towards the blastic sympodial, catenulate, porogenous, terminal conodiophores.

Fotos / Sonidos

Observ.

huafang

Fecha

Noviembre 1, 2016 a las 04:00 TARDE EDT

Fotos / Sonidos

Observ.

huafang

Fecha

Noviembre 1, 2016 a las 01:03 TARDE EDT

Fotos / Sonidos

Observ.

huafang

Fecha

Noviembre 1, 2016 a las 01:25 TARDE EDT

Fotos / Sonidos

Observ.

huafang

Fecha

Noviembre 1, 2016 a las 02:46 TARDE EDT

Fotos / Sonidos

Observ.

huafang

Fecha

Noviembre 1, 2016 a las 03:43 TARDE EDT

Fotos / Sonidos

Observ.

jackjohnsonn

Fecha

Agosto 23, 2022 a las 04:56 TARDE CDT

Descripción

Under Picea. Unusual out of range observation, some reddening on tapered stem, fruiting next to Hydnum sp. Strong "grape candy" odor.
Fruits 2-5.25cm across. Possibly a range extension finding. Drying quite pink. I see collections on mycoportal from North Carolina & Newfoundland, but nothing from the midwest.

Etiquetas

Fotos / Sonidos

Observ.

jackjohnsonn

Fecha

Agosto 25, 2022 a las 03:28 TARDE CDT

Descripción

Or perhaps Paralepista? Under Pinus. Growing on buried wood and woody debris.

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Febrero 9, 2024 a las 07:32 TARDE CST

Descripción

Hyperparasitic on a Xylariales fungus
(Second fungus was confirmed)

Microscopically, this fungus had:
cleistothecia coated in setae
IKI- asci containing 8 ascospores
Hyaline, guttulate spores that were slightly curved but not fully allantoid.
The spores became yellow in color in Lugols solution.

Seems to match Nitschkia brevispina

I believe the olivaceous KOH extractable pigments are coming from the second fungus (Hypoxylon?) growing underneath the discs. I observed two types of spores.

Fotos / Sonidos

Qué

Hongos Ascomicetes Y Líquenes (Subfilo Pezizomycotina)

Observ.

tom1548

Fecha

Febrero 2, 2024 a las 02:46 TARDE EST

Descripción

Black discs

Underlying crust fungus unknown, posted here
https://www.inaturalist.org/observations/198237084

4th photo from different log. It's host crust fungus is posted here
https://www.inaturalist.org/observations/198235655

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Junio 9, 2023 a las 04:36 TARDE CDT

Descripción

Leaves with mature fungus collected 02/07/2024

Chasmothecia abundant - each body encasing one singular ascus housing 8 ascospores.

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Febrero 5, 2024 a las 07:41 TARDE CST

Descripción

Host: Betula nigra

Smooth diatrypous fruit body, very thin - like a single celled layer with no clear body.

No asci observed, possibly anamorphic.

Spores dyed in lactophenol cotton blue - only staining the apical segments

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Julio 29, 2023 a las 03:07 TARDE CDT

Descripción

Robust

Strong green reaction to 365nm UV light when dried!

Microscopy:

Pigmented sub-globose spores

Found what appears to be conidia and conidiophores hanging out in the gills of this.

Fotos / Sonidos

Observ.

tom1548

Fecha

Febrero 6, 2024 a las 02:05 TARDE EST

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Mayo 1, 2021 a las 10:36 MAÑANA EDT

Descripción

On a small hardwood branch with the bark beginning to fall away. Note the white lesions in the bark and wood beneath. Perithecia up to 1mm wide by 1.5mm tall.

Asci: 153-168 x 7.5-10µm. The spore bearing part 105-125µm. IKI+, the apical plug about 2.5 tall x 3µm wide when mature; much longer in immature asci.

Spores: 13-14 x 6-7µm, brown, ellipsoid to inequalateral ellipsoid, guttulate, usually with one large guttule at the center, with a very inconspicuous germ slit less than spore length.

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Diciembre 19, 2021 a las 02:29 TARDE EST

Descripción

Spores 13.5-22.5 x 4.3-5.6µm, mostly 3-septate.

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Agosto 2021

Descripción

On the ground in Hemlock-Birch-Pine forest. Apothecia quite small, about 2 cm tall, the head 11mm tall by 6mm wide. Asci 127-170 x 11-16µm. Spores 22-41 x 5.5-7µm, hyaline, multiguttulate, they appear aseptate, but may be immature. Paraphyses mostly straight, some curved and slightly swollen at the apex. The dimensions of the spores and asci are a little on the large size for T. atropurpureum, but I can't figure what else it could be.

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Febrero 11, 2023 a las 12:32 TARDE EST

Descripción

Spores brown, one septate, smooth, 9-10.5 x 3.7-4µm

Asci bitunicate, clavate, very faintly IKI+, staining faintly blue over much of the upper surface, 44-56 x 9-10µm

Paraphyses septate, slightly constricted at the septa, up to 4.3µm wide at the tips.

Excipulum textura angularis

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Noviembre 19, 2023 a las 10:01 MAÑANA EST

Descripción

On London Plane. I think there are 64 spores per ascus (hard to count).

Spores 6.5-9.8 x 1.4-1.9µm, allantoid, light yellow-brown.

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Octubre 21, 2023 a las 10:20 MAÑANA EDT

Descripción

Growing on Honey Locust seed pods.

Spores ellipsoid, tapering at the ends (roughly boat shaped), mostly without oil content: 7.8-10.3 x 3.2-4µm

Asci IKI-, with croziers, 66-74 x 5-6µm

Paraphyses branched, containing some refractive content. Occasionally roughened at the ends.

Hairs indicated by arrows in microphotos

Excipulum textura intricata.

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Febrero 4, 2024 a las 11:34 MAÑANA EST

Descripción

Collected by Sigrid Jakob

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Febrero 4, 2024 a las 10:55 MAÑANA EST

Descripción

On a rotting baseball bat (found by Sigrid Jakob).

Fotos / Sonidos

Observ.

matt227

Fecha

Febrero 4, 2024 a las 04:25 TARDE CST

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Mayo 29, 2023 a las 11:31 MAÑANA CDT

Descripción

No idea. Seemed like a gall wasp. There was a group of maybe 20 of them hovering over a pile of oak leaves, dipping onto the ground periodically

Etiquetas

NMC

Fotos / Sonidos

Observ.

maricel-patino

Fecha

Mayo 31, 2021 a las 08:09 TARDE EDT

Descripción

Sharing and abandoned pine plank that was against the ground, with a Peniophora sp. and an ascomycete. Spores of crust and ascomycete can be seen. Although most of the spores have three teeth, there were few bearing four teeth. Woods of Wenonah.

Fotos / Sonidos

Observ.

maricel-patino

Fecha

Enero 31, 2024 a las 02:16 TARDE WET

Descripción

On rotten hardwood. Mossy woods. Sharing the substrate with a resupinate polypore. Crust in its asexual form. It has a very loose consistency. Powdery to touch (tons of conidia) and very delicate. Grayish-greenish.

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Junio 22, 2021 a las 02:48 TARDE EDT

Lugar

Marquette (Google, OSM)

Fotos / Sonidos

Observ.

manofthemarsh

Fecha

Noviembre 12, 2021 a las 06:02 TARDE EST

Descripción

R. rostratus- 11 superposed receptacle cells (excluding foot) form a slight expansion towards inflated perithecial venter with elongated neck distally.
The neck may also act as a trigger to disperse spores when disturbed. The spermatial rods detach from the antheridial branches once adhered to the trichogyne, and can release sperm after separation. As an aquatic species, the currents would otherwise prevent the antherozoids from adhering to the trichogyne long enough for sperm contact. This species represents a transitional state between exogenous and endogenous spermatia. The exogenous spermatia produced will discharge sperm freely through a short tube much like endogenous spermatia. The basal axis of the appendage appears to be incorporating itself into the perithecial wall as part of typical development.
Specimen host: Male Cymbiodyta toddi found under submerged debris. ***First Laboulbeniales infection for the species. Though, not new for the genus, even in the US (R. rostratus on C. fimbriata in MA, TX).
Specimen Position: Attached from beneath the right apical angle of the pronotum.
Host Infection: Most likely through contact of right fore-tarsus with infected soil or leaf litter followed by routine grooming by the host OR the host may have been mounted on its anterior portion by another male carrying spores on its left fore-tarsal claw.

Fotos / Sonidos

Observ.

manofthemarsh

Fecha

Marzo 10, 2022 a las 02:53 TARDE EST

Descripción

Genus diagnosed by transverse white and orange bands on frons. Species characterized by lustrous spot (radiating from anterior ocellus) that does not reach halfway to eye margin. Specimen found drinking sap from wounded Cladastris kentukea and was easily caught with a microvial.

Fotos / Sonidos

Observ.

maricel-patino

Fecha

Marzo 26, 2022 a las 04:50 TARDE EDT

Descripción

Troops of brown septate and pointy conidiophores growing on an old unknown fungus. Conidia grows at tip. Mixed woods with hemlock.

Fotos / Sonidos

Observ.

huafang

Fecha

Junio 13, 2022 a las 08:58 MAÑANA EDT

Descripción

This observation is for the "dots" on the Xylaria.
Conidia (from Xylaria?) 6.1-9.7 x 2.5-3.9µm

Fotos / Sonidos

Observ.

maricel-patino

Fecha

Diciembre 22, 2018 a las 12:51 MAÑANA EST

Descripción

Dark brown spiny spheres on polypore, growing on dark brown subiculum.Jellied inside. 0.8mm size, the biggest. Starts with few individuals and becomes crowded until big areas are covered with dark brown mycelium.

Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

manofthemarsh

Fecha

Enero 25, 2024 a las 01:03 TARDE CST

Descripción

A mold growing on a dead scorpion in a terrarium. The scorpion was dead prior to mold colonization.

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Observ.

psweet

Fecha

Agosto 9, 2013 a las 06:19 MAÑANA CDT

Descripción

SONY DSC

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Julio 29, 2023 a las 01:12 TARDE CDT

Descripción

Collared bulb suggests section Amanita
Ring, white stem, and striate cap margin make me think a worn Amanita frostiana.

But, the warts are white.

@logan_borosch
Any idea? Am I way off?

Fotos / Sonidos

Qué

Hongos de Repisa (Orden Polyporales)

Observ.

sbrobeson

Fecha

Enero 2024

Descripción

on dead wood of Elaeagnus umbellata

Fotos / Sonidos

Observ.

carson69

Fecha

Enero 17, 2024 a las 08:32 TARDE CST

Fotos / Sonidos

Observ.

tom1548

Fecha

Enero 18, 2024 a las 02:05 TARDE EST

Fotos / Sonidos

Observ.

makielb

Fecha

Agosto 29, 2014 a las 10:37 MAÑANA EDT

Fotos / Sonidos

Observ.

mycologic

Fecha

Septiembre 28, 2023

Descripción

Found growing under hemlock.

Fotos / Sonidos

Observ.

dziomber

Fecha

Julio 24, 2023 a las 03:17 TARDE CDT

Descripción

In an old growth hemlock forest

I haven't been able to find any solid matches. The grayish color of the stem and cap, and the volva with orange-buff color on the inside seem relatively distinct

Amanita clarionensis is the best match I've found yet. It occurs in eastern NorthAmerica, under oak, pine, and hemlock. Though it seemingly has a less gray pileus and stipe, and fully white volva

Fotos / Sonidos

Observ.

mipiworld

Descripción

Found in mulch at a landscape supply yard. Interesting sclerotia. Mid-Michigan.

Fotos / Sonidos

Observ.

sbrobeson

Fecha

Enero 2024

Descripción

not collected as I only see a couple stems, but I could grab at least one if that would be helpful.
@dylantomtaylor @pipsissewa

Fotos / Sonidos

Observ.

cooperj

Fecha

Abril 2, 2023 a las 09:36 MAÑANA NZST

Descripción

isolated from log as a contaminant of a Basidiodendron

Fotos / Sonidos

Observ.

cooperj

Fecha

Abril 3, 2020 a las 05:09 TARDE +13

Descripción

Hyphomycete parasitic in this case on the basal hyphae of Marasmiellus candidus (characterised by basal cushions from which sporocarps emerge, and really Campanella).
Conidia 4 x 1.5um, Q=2.7. Conidiogenous cells 15 x 2um.

Fotos / Sonidos

Observ.

mipiworld

Fecha

Octubre 2023

Descripción

Definitely Pluteus, BUT I do not believe this is P. cyanopus or P. americanus. Mixed deciduous forest, mid-Michigan, growing from dead tree stump near drainage ditch. Help with ID? Another specimen of this species was found and sent to the mycoblitz fall 2023. Have not heard yet what the sequencing has to say about it.

Fotos / Sonidos

Observ.

thaddeus25

Fecha

Octubre 29, 2021 a las 12:45 TARDE EDT

Descripción

Gilled mushroom exhibiting very deep blue/violet coloration, not sure if it's from the mushroom or some other source.

Fotos / Sonidos

Qué

Setas, Bejines Y Parientes (Clase Agaricomycetes)

Observ.

tom1548

Fecha

Enero 3, 2024 a las 03:22 TARDE EST

Fotos / Sonidos

Observ.

daviswj

Fecha

Junio 20, 2016

Descripción

Stored as culture # 750 in the UMich culture collection

Fotos / Sonidos

Fecha

Agosto 21, 2022 a las 04:37 TARDE CDT

Fotos / Sonidos

Observ.

ethancrenson

Fecha

Abril 27, 2019 a las 01:15 TARDE EDT

Descripción

On Platanus x acerifolia. The anamorph is shown here: “Macrodiplodiopsis desmazieresii”

Fotos / Sonidos

Fecha

Diciembre 9, 2023 a las 12:15 TARDE JST

Descripción

Lecanicillium anamorph

Etiquetas

Fotos / Sonidos

Observ.

flowntheloop

Fecha

Diciembre 2023

Descripción

ID tentative, but this is my best guess. Found in rosette formation on Privet ( Ligustrum sinense )

Fotos / Sonidos

Observ.

sbrobeson

Fecha

Diciembre 24, 2023 a las 05:06 TARDE EST

Fotos / Sonidos

Observ.

sbrobeson

Fecha

Octubre 2, 2023 a las 06:38 TARDE CDT

Fotos / Sonidos

Qué

Hongos de Repisa (Orden Polyporales)

Observ.

sbrobeson

Fecha

Diciembre 2023

Fotos / Sonidos

Observ.

dylantomtaylor

Fecha

Octubre 21, 2023 a las 12:02 TARDE CDT

Descripción

It’s growing on a peach pit!! Just realized the substrate

Spores huge - micro photos at 400x (no measurements yet)

Spores citriform with apical germ pores on each end; coated in a thick gelatinous membrane. Some of the spores were singularly septate.

Seemingly 3 spores per ascus, more likely they were 4 spored and I was just not finding them.

Etiquetas

CMC, NMC

Fotos / Sonidos

Fecha

Marzo 29, 2023 a las 05:04 TARDE EDT

Fotos / Sonidos

Qué

Hongos Anacates (Género Cantharellus)

Observ.

jackjohnsonn

Fecha

Agosto 2022

Descripción

Growing with Jack pine, and other conifers. Large, very aromatic.

Fotos / Sonidos

Qué

Setas, Bejines Y Parientes (Clase Agaricomycetes)

Observ.

maricel-patino

Fecha

Diciembre 17, 2023 a las 10:16 TARDE WET

Descripción

Very sticky. It has an incredible delicious smell. The cap stayed wet even one day after being picked up. Gills had a gelatinous consistency and released matter in the preparation. KOH negative on cap. Edge of cap is white and made of thin hyphae with clamps. Cystidia is absent. Cap 1.1 cm; stipe 1.7 cm.

Fotos / Sonidos

Observ.

alexgraeff

Fecha

Abril 2023
Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

dpmarton

Fecha

Diciembre 15, 2023 a las 02:38 TARDE CST

Fotos / Sonidos

Qué

Hongos Coral Y Parientes (Familia Clavariaceae)

Observ.

hills47448

Fecha

Agosto 19, 2023 a las 11:24 MAÑANA EDT

Fotos / Sonidos

Observ.

matt227

Fecha

Diciembre 16, 2023 a las 01:46 TARDE CST

Descripción

Dang it I know this one but can't find it. Rufus rubber cup? Clustered aspen cup? Felgercarb!

Photos by Nancy Nabak

Fotos / Sonidos

Observ.

maricel-patino

Fecha

Noviembre 21, 2023 a las 09:16 TARDE WET

Descripción

Parasitizing Clavulina cristata. The coral looks like a disfigured gray mass. Park; side of hill.

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Observ.

huafang

Fecha

Septiembre 6, 2023 a las 01:04 TARDE EDT

Fotos / Sonidos

Qué

Hongos de Repisa (Orden Polyporales)

Observ.

tom1548

Fecha

Diciembre 13, 2023 a las 03:12 TARDE EST

Fotos / Sonidos

Observ.

filipfuljer

Fecha

Enero 2, 2022 a las 05:54 TARDE CET

Descripción

on the dead attached branch of Salix sp.

Fotos / Sonidos

Observ.

sbrobeson

Fecha

Noviembre 28, 2023 a las 05:03 TARDE EST

Descripción

on dead wood of probably Quercus velutina

Fotos / Sonidos

Qué

Hongos Ascomicetes Y Líquenes (Subfilo Pezizomycotina)

Observ.

rambryum

Fecha

Noviembre 6, 2022 a las 07:20 MAÑANA CST

Descripción

On poplar leaf

Fotos / Sonidos

Observ.

tombigelow

Fecha

Agosto 14, 2020 a las 11:57 MAÑANA EDT

Fotos / Sonidos

Observ.

andrewkhitsun

Fecha

Septiembre 4, 2021 a las 11:22 MAÑANA CDT

Fotos / Sonidos

Observ.

aldendirks

Fecha

Mayo 10, 2019

Descripción

I initially thought this was Sarea sp., but looking at the black structures under a dissection microscope they are not apothecia, but perhaps perithecia.

Image #21: Potential apothecia. Source of ascus-like structures (bitunicate asci?)

Additional notes for sequences (bases on the right):

ITS: Corresponds to Claussenomyces aff. olivaceus

Additional sequences:

ITS, partial LSU: Corresponds to Sarea difformis

ACD0147.1a_ITS1F-LR3
CGTAGGTGACCTGCGGAGGATCATTACCGAGTAAGGGTCTCTCAGGCCCG
ATCTCCCACCCTATGTGTACCTACCTTTGTTGCTTTGGCGGGCCCGCTGG
GGCAACCCACCGTCGGCTTCGGCTGGCGAGCGCCCGCCAGAGACCATCCA
AACTCTGTTTATCAGTGTCGTCTGAGAAAAAACACAATAGTTAAAACTTT
CAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGC
GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACG
CACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATT
ACACCACTCAAGCTCAGCTTGGTATTGGGCCCTCGTCCCTCGGGACGTGC
CTGAAAATCAGTGGCGGTGCTGCCTGACTTCAAGCGTAGTAATTTCTACC
CTCGCTTTGGAAGCTCGGGACGTGTGCCTGCCATACAACCCCCATCTTTT
TATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC
AATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGT
GAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTT
GTAATTTGTAGAGGATGCTTCGGGCGTGGCGCGGGTCTAAGTTCCTTGGA
ACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGACCCATCGCCTCCGT
CCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAA
ATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGC
GCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAA
AAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCTCG
CGGTTGCTCAGCCGGTGTTCTCACCGGTGCACTCTTCCGCGATCAGGCCA
GCATCGGTTTGGGCGGCTGGATAAAGGCTTCGGGAATGTAGCTCCTCTCG
GGGAGTGTTATAGCCCGGGGTGCAATGCAGCCTGCCCGGACCGAGGACCG
CGCTTCGG

ITS, partial LSU: Corresponds to Sarea resinae

ACD0147.3_ITS1F-LR3
GTGACCTGCGGAGGATCATTACCGAGTTAGGGTCCTCTGGGCCCGAATCT
CCAACCCTCTGTATATCTACCTCATGTTGCTTTGGCGGGCCGTTGGGCCT
GGCCCACCGTCGGCTTCGGCTGGCGCGCGCCCGCCAGAGACCATCTCAAA
CTCATGTTTATCAATGTCGTCTGAGTACTATATAAATAGTTAAAACTTTC
AACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCG
ATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC
ACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTA
CACCACTCAAGCTCTGCTTGGTATTGGGCCCTCGTCCTCTTGGGGACGTG
CCCGAAAATCAGTGGCGTCGCCGCCTGACTTCAAGCGCAGTAATTCTTCT
CGCTTTGGAAGGAAGGGTCGGTTTGACTGCCAGACAAACCCATTATTTTT
CTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT
CAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAG
TGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGT
TGTAATTTGTAGAGGATGTTTCGGGTGTGGCTCCGGTCTAAGTTCCTTGG
AACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAGCCTTCG
TCCATGTGAAACTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAA
AATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCAGAGACCGATAG
CGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTA
AAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCTC
GCGGTTGCTCAGCCGGTGTTCTCACCGGTGCACTCTTCCGCGATCAGGCC
AGCATCGGTTTAGGCGGCTGGATAAAGGCCCTGGGAATGTAGCTCCTCTC
GGGGAGTGTTATAGCCCGGGGTGCAATGCAGCCCGCCTGGATCGAGGACC
GCGCT

ITS: GenBank MZ919155

Originally posted to Mushroom Observer on May 15, 2019.

Fotos / Sonidos

Observ.

aldendirks

Fecha

Abril 29, 2019

Descripción

Hirsutella is the deprecated name for Ophiocordyceps anamorphs. Simmons et al. (2015), Phylogeny of Hirsutella species (Ophiocordycipitaceae) from the USA: remedying the paucity of Hirsutella sequence data, present two species with Elateridae reported as the host: Ophiocordyceps brunneipunctata and Ophiocordyceps stylophora.

Additional sequences:

ITS: GenBank MW464416

Originally posted to Mushroom Observer on Apr. 30, 2019.

Fotos / Sonidos

Observ.

aldendirks

Fecha

Junio 7, 2019

Descripción

Additional sequences:

ITS: GenBank MZ919168

Originally posted to Mushroom Observer on Jun. 9, 2019.

Fotos / Sonidos

Observ.

aldendirks

Fecha

Mayo 20, 2020

Descripción

Additional sequences:

ITS: GenBank MZ919220

Originally posted to Mushroom Observer on May 21, 2020.

Fotos / Sonidos

Qué

Hongos Llorones (Género Lacrymaria)

Observ.

aldendirks

Fecha

Junio 9, 2020

Descripción

Growing spaced apart in lines in middle and at edge of mossy gravel path

Additional sequences:

ITS: GenBank MZ919230

Originally posted to Mushroom Observer on Jun. 17, 2020.

Fotos / Sonidos

Observ.

aldendirks

Fecha

Junio 9, 2020

Descripción

Additional sequences:

ITS: GenBank MZ919229

Originally posted to Mushroom Observer on Jun. 17, 2020.

Fotos / Sonidos

Observ.

sigridjakob

Fecha

Julio 14, 2023 a las 12:26 TARDE EDT

Fotos / Sonidos

Observ.

sigridjakob

Fecha

Julio 18, 2023 a las 10:51 MAÑANA EDT

Descripción

Under oak, in leaf litter

98.97% match to type of Agaricus tennesseensis

Fotos / Sonidos

Observ.

sadie_hickey

Fecha

Julio 7, 2019 a las 12:06 TARDE PDT

Fotos / Sonidos

Observ.

verpahh

Fecha

Agosto 1, 2023 a las 06:35 TARDE EDT

Fotos / Sonidos

Observ.

verpahh

Fecha

Agosto 2, 2023 a las 08:12 TARDE EDT

Fotos / Sonidos

Observ.

lothlin

Fecha

Agosto 13, 2023 a las 11:54 MAÑANA EDT

Fotos / Sonidos

Observ.

taigamushrooms

Fecha

Septiembre 19, 2023 a las 04:22 TARDE CDT

Fotos / Sonidos

Observ.

taigamushrooms

Fecha

Septiembre 19, 2023 a las 03:35 TARDE CDT

Descripción

Sweet odor