Creciendo en partes de un arbol de Ficus elastica, Agosto 2021
Observed under mature ficus tree in the leaf mold.
Substrate: emerging from very decomposed bibosi trunk
Habitat: dry semideciduous forest [Curupaú (Anadenanthera colubrina) / Motacú (Attalea phalerata) / Bamboo (Chusquea spp.) / Bibosi (Ficus sp.)]
Ecoregion: intersection of Chiquitano Dry Forests (NT0212) and Cerrado Savanna (NT0704)
Collectors: D. Newman, I. Cuba Pinto, E. Melgarejo Estrada, D. Camacho Ramirez & S. Montaño Poquiviqui.
Collection #: DSN12.294 (SS85)
found it on the soil for our orchids
There’s some kind of fungus or eggs growing in the soil of my aloe vera plant. 90% growing on the side that is turned away from the window and more shaded by the plant, there’s also a small amount on the other side of the plant as well.
Fungus growing beneath my Aloe Mitriformis. Largest toadstool in picture is 15mm across.
Found as slightly green spot in dirt of potted snake plant on 9/6/22. Transferred to MA plate 9/12/22. Restreaked 10/2/22. Grows as light white fuzz on MA plate with black specks. Microscopic images of sporangia show a line at the base of the "bulb" portion, indicating the presence of a vesicle that likely ruptured from the set up for microscopy viewing.
tiny mushrooms growing in plant pots filled with compost
Growing in potted plant indoors
I found these two tiny mushrooms in my indoor mint plant. Very surprising. I’ve never seen mushrooms appear in an indoor plant!
Curious what they are and how they got here!
The caps are about the size of a pinky fingernail. The tops have a dark circle at the center. Stems are ver then and they both bent over.
Growing on woody debris from an Acer saccharinum that's been kept in a humidity chamber indoors for a few weeks.
The smaller spores were about 21-24.3um range. The largest spore was about 45um long by 29.5um
Found in my indoor houseplant in MN. It has a yellow tint which I couldn’t capture with my camera
Growing in flowerpot in My house (Shanghai, China).
Hyline spores measured 7-9×5-7.5µm.
According to GIERCZYK & GRZEGORZ 2014 my specimen may match the description of L. lilacinogranulosus instead of L. ianthinus, but Species Fungorum treats L. lilacinogranulosus as a synonym of L. ianthinus.
En tocón de higuera muerta, naciendo en grupos de varios ejemplares de la base del tronco en contacto con el suelo.
Aspecto frágil, blanco inmaculado con escamas flocosas que se desprenden al tacto. Somprero de 7 cm diámetro con el margen incurvado.
Pie largo, estrecho arriba y ensanchado de forma peculiar hacia la base.
Anillo colgante, en faldilla, móvil.
Láminas blancas, densas, escotadas.
Carne blanca, muy ténue.
Olor fúngico con matices desagradables.
Esporas Me= 9,4 x 5,9 ym
Qe= 1,6
This mushroom came up in the pot of an orchid from the Trader Joe's in Napa that I had in the same in my house for years. It had a very dry look and feel.
possibly yellow pot-plant mushroom? although it’s growing in the garden?
Two small white mushrooms growing in a plant pot. Last photo taken 8 hours after the first 3 photos. Caps to 25 mm across with patches of veil remnants present. Gills white.
Found in the pot of a Aloe Vera plant (not a new plant) kept outdoors during hot weather.
These balls are growing on perlite in a “living soil” and are about the size of a fungus gnat. They were growing on the perlite found underneath a plastic cup sitting on the soil surface. I’ve seen this before in other potting soil that I’ve made.
A mold or other fungi. It is growing on a composting paper coffee filter. Small 6" square patch if this in compost bin. Removed from bin for inspection.
Growing out of flower pot at outdoor nursery.
Growing in a decorative plant pot
23 hours prior: https://www.inaturalist.org/observations/30973342
19 hours later: https://www.inaturalist.org/observations/30973562
growing in a decorative plant pot
42 hours prior: https://www.inaturalist.org/observations/30973342
19 hours prior: https://www.inaturalist.org/observations/30973423
Growing in a decorative plant. i have photos of it after it opened and another from when it died. I will add the link here to those observations when they are uploaded
23 hours later: https://www.inaturalist.org/observations/30973423
42 hours later: https://www.inaturalist.org/observations/30973562
Sighting and photos (c) paul_fiona_rose_grace_rob.
Field Notes - A cluster of firm yellow-orange balls just emerging from beneath leaf litter. All of the balls are joined by small branches to a central stem or root system. Each bell is 4-5mm in diameter.
Yellow - not sure if it is plant roots or maybe some sort of fungi?
Growing on the yard, had bright yellow liquid coming from the stem
Top blast hit: Leucocoprinus cretaceus
10umx6um
LC1_ITS4rev
CTTGGTCCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATATTCTCGATGGGTTGTAGCTGGCTCCTCGGAGCATGTGCACGCCTGTCTTGACTCTATTCATCCACCTGTGCACTTATTGTAGTCTCATTCGAGGGTAGTCGGTCGGCAAGACCGGATGTGAGGGATGCAGCGCGAAAGTGCGGCACCTCTCTGGCTCTGGGTGGACTATGTCTTTATTCATAAACCACGTAGTATGTTGCAGAATGTATTCAATGGGCCTTTGTGCCTATAAAAACCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAGTAAATTCTCAACTCCACTAGCTTTTGTTAGTCGGAGCTTGGATGTGGAGGTTTTGCGGGCCTTTTCAAAGGTCGGCTCCTCTGAAATGTATTAGCGGAACCGTTTGCGACTCCGTCACAGGTGTGATAATTATCTACGCCAGTGGATCGCTCTCTGTCTGTTCAGCTGCCAACCGTCCCTCGGGACAAACTTACTGAACTTTGACCTCAAATCAGGTAGG
Found in one of my plant pots indoors for my ponytail tree. Its got a compartment at the bottom seperate for water which must be keeping the soil too moist. I took some photos of the growth over 4 or 5 days.
Have no idea what this is, not sure if it's fungi, plant or mould. was firm to the touch, nearly prickly.
Have been told that this is Ozonium and is from the Coprinellus sp
Found these growing in my vermicompost bin. I recently added a block of failed oyster mushroom spawn that had been contaminated. Not sure if these are from something that survived in the substrate or are fungi that were already in my bin that colonized the substrate and fruited. They look like inky caps to me but not enough to ID them as such.
I don’t know how the photos totally missed showing the yellow, but these were quite yellow.
In a pot with a palm
podría ser*
Datos de Yopal: registrado en Bosque Seco Tropical (temporada de lluvia). Precipitación mínima de 15 – 25 mm en los meses de enero y diciembre, precipitación máxima 350 mm y 300 mm en los meses de mayo, junio y julio; con menos de 60 mm de lluvia en el mes más seco y precipitación anual superior a 1270 mm. Cuenta con valores mínimos de humedad relativa a inicio del año (65%), y valores más altos en junio, julio, agosto y septiembre (90-85%). Cuenta con una altura sobre el nivel del mar entre 0 y 1000 m, una pluviosidad entre 2000 y 4000 mm y temperatura promedio mayor de 24 °C, con amplitud de temperatura máxima de 8 °C, como se referencia en DANE. Los máximos valores de temperatura no sobrepasan los 36 °C y los mínimos valores no logran bajar los 19 °C que se presentan en febrero y en julio, respectivamente. Temperatura media anual mayor de 20 °C, con una estación seca y una lluviosa bien definidas (Bustamante et al., 2017; DANE, 1999; Castro y Sosa, 2017).
Se observa con frecuencia plantas representativas de la zona como Yarumo (Cecropia peltata), Jobo (Spondias mombin), Cedro (Cedrela odorata), Nauno (Albizzia guachepele), Cañafistol (Cassia moschata), Flor blanco (Tabebuia orinocensis), Uña de gato (Cynodon dactylon), entre otras.
Te dejo algunas recomendaciones para tus registros. Las fotografías y descripciones que hagas, te van a permitir identificar el ejemplar: más detalles ver: https://colombia.inaturalist.org/journal/teodoro_chivatabedoya/54937-registro-de-hongos-macromicetos
-Tomar fotografías de las diferentes estructuras del basidioma/ascoma/cuerpo fructifero/carpoforo/seta (por encima, por debajo y de perfil), su estipe (píe), píleo (sombrero) y base. En el caso de retirar el ejemplar sin conocerlo, debes comprometerte a realizar una descripción detallada para aportar a su conocimiento y que no quede en una muestra arrancada, fotografiada y desechada. Para trabajos de identificación, es necesario que retires el ejemplar completo, sin cortar o maltratar la base del estípite, de igual forma, tomar nota del tipo de sustrato (material donde crece y desarrolla).
-Es importante que describas las dimensiones (altura y diámetro), forma, consistencia, textura, color y olor. Recuerda que los ejemplares cambian bastante según su estado de desarrollo, así que es ideal familiarizarse con la zona y temporada en la que crecen, para hacer un seguimiento y logres observar la variabilidad fenotípica del basidioma o ascoma (cuerpo fructífero).
-Toma fotos del entorno y agrega datos del ecosistema (humedad, temperatura, altura, tipo de bosque, insectos asociados, etc).
-No olvides que la determinación de macromicetos es compleja y no se realiza únicamente con fotografías, esta tarea (a nivel de género y especie; en la mayoría) implica actividades de descripción morfológica externa e interna, esporada, reacciones químicas, microscopia e incluso herramientas moleculares (ADN/PCR).
Hongos de Colombia (Bogotá, 2019):
https://www.researchgate.net/publication/343651635_Hongos_de_Colombia_Contribucion_al_Conocimiento_de_la_Biota_Fungica_en_Ecosistemas_de_Humedal_Bosques_Andinos_Subparamos_y_Paramos_de_Bogota_DC
Otras recomendaciones en:
Grupo XYLARIA Hongos de Colombia ©2016
FACEBOOK: www.facebook.com/groups/xylariahongosBogota/
INSTAGRAM: https://www.instagram.com/hongos_colombia/
teodorot@outlook.es 3102084355
Datos de Yopal: registrado en Bosque Seco Tropical (temporada de lluvia). Precipitación mínima de 15 – 25 mm en los meses de enero y diciembre, precipitación máxima 350 mm y 300 mm en los meses de mayo, junio y julio; con menos de 60 mm de lluvia en el mes más seco y precipitación anual superior a 1270 mm. Cuenta con valores mínimos de humedad relativa a inicio del año (65%), y valores más altos en junio, julio, agosto y septiembre (90-85%). Cuenta con una altura sobre el nivel del mar entre 0 y 1000 m, una pluviosidad entre 2000 y 4000 mm y temperatura promedio mayor de 24 °C, con amplitud de temperatura máxima de 8 °C, como se referencia en DANE. Los máximos valores de temperatura no sobrepasan los 36 °C y los mínimos valores no logran bajar los 19 °C que se presentan en febrero y en julio, respectivamente. Temperatura media anual mayor de 20 °C, con una estación seca y una lluviosa bien definidas (Bustamante et al., 2017; DANE, 1999; Castro y Sosa, 2017).
Se observa con frecuencia plantas representativas de la zona como Yarumo (Cecropia peltata), Jobo (Spondias mombin), Cedro (Cedrela odorata), Nauno (Albizzia guachepele), Cañafistol (Cassia moschata), Flor blanco (Tabebuia orinocensis), Uña de gato (Cynodon dactylon), entre otras.
Te dejo algunas recomendaciones para tus registros. Las fotografías y descripciones que hagas, te van a permitir identificar el ejemplar. Más información en: https://colombia.inaturalist.org/journal/teodoro_chivatabedoya/54937-registro-de-hongos-macromicetos
Hongos de Colombia (Bogotá, 2019):
https://www.researchgate.net/publication/343651635_Hongos_de_Colombia_Contribucion_al_Conocimiento_de_la_Biota_Fungica_en_Ecosistemas_de_Humedal_Bosques_Andinos_Subparamos_y_Paramos_de_Bogota_DC
Bibliografía General de Macromicetos:
https://drive.google.com/drive/folders/19VZivWVc5ueyBABX73KIfBGei9smvMzh?usp=sharing
Otras recomendaciones en:
Grupo XYLARIA Hongos de Colombia ©2016
FACEBOOK: www.facebook.com/groups/xylariahongosBogota/
INSTAGRAM: https://www.instagram.com/hongos_colombia/
teodorot@outlook.es